Home  ›  What Happens to the Ovary if the Broiler Breeder is Over Feed

What Happens to the Ovary if the Broiler Breeder is Over Feed

Written By Wednesday, October 5, 2022 Add Comment Edit

Abstract

Ad libitum

feeding in broiler breeder (BB) hens causes reduced egg production, lower fertility, and improper eggshell deposition. Restricted feeding (RF) is the only effective intervention available to normalize ovarian function and improve reproductive efficiency. This study aimed to assess the transcriptional changes in ovarian cortex of BB hens with free access to feed compared to those on a RF diet. RNA was isolated from the ovarian cortex of Cobb 500 pullets raised to 10 and 16 weeks of age on either a full-feeding (FF) or RF diet. Microarray analysis identified 386 differentially expressed genes between the two feeding groups at 16 weeks of age. Gene ontology enrichment identified overrepresentation of Neuroactive ligand–receptor interaction pathways, Cell adhesion molecules, Steroid hormone biosynthesis, and various KEGG pathways. From these groups, 46 genes were selected for follow-up validation by quantitativePCR. The findings show that 33 of the 46 genes had significantly different abundance by age and/or feeding level. Most of these genes were repressed in RF hens and belonged to the steroid biosynthesis and neuropeptide signaling groups. The VIPR2 receptor was higher in the FF group leading us to hypothesize that vasoactive intestinal peptide (VIP) is an important regulator of small cortical follicles. Culture of hen cortical follicles with VIP increased Star, an indication of increased steroidogenic activity, although did not elevate Cyp11a1. These results offer insights and suggest the possible mechanisms and pathways responsible for the increases in cortical follicle growth associated with excess feed intake in BB hens.

Lay summary

Giving breeder hens unrestricted access to feed can lead to problems with their ovaries, including excessive growth of the ovary and reduced fertility. Giving a limited amount of feed is the only effective way to reduce this growth of the ovaries and improve fertility. This study aimed to assess the changes in the molecules that make proteins in the body in hens fed unrestricted and restricted diets. In the hens fed a limited amount of feed, there were more of one type of molecules, while there were more of another type in the ovaries of hens with unrestricted access to feed. These results show that how much a hen eats can alter the number of these molecules in the ovary and this could help us understand why their ovaries grow excessively and why their eggs are less fertile.

Introduction

Genetic selection for growth rate, feed intake, feed conversion, and meat yield of broiler breeder (BB) lines has led to an increase in hen growth by over four-fold since 1957 (Zuidhof et al. 2014). Consequently, this genetic selection strategy has diminished reproductive efficiency. When given free access to feed, BBs will exceed the caloric intake required for optimal growth, resulting in metabolic dysfunction, increased lipid deposition, and associated ovarian dysfunction. The exact relationship between the level of feed, changes in metabolism, and reproductive dysfunction is not entirely clear. Currently, the most effective intervention to improve BB reproductive efficiency is through significant caloric restriction (Yu et al. 1992a, b, Robinson et al. 1993, Hocking & McCormack 1995). However, a promising new study suggests that modulating light wavelength can improve BB reproductive performance (Zaguri et al. 2020).

Ovarian dysfunction observed in BBs fed ad libitum is most apparent from the excessive number of hierarchical follicles that cause double ovulations, internal ovulations, improper eggshell deposition, and reduced fertility (Yu et al. 1992a, b, Robinson et al. 1993, Hocking & McCormack 1995). Collectively, these defects result in the production of fewer eggs of lower quality in comparison to laying hens (Yu et al. 1992b, Hocking & McCormack 1995, Chen et al. 2006, Diaz & Anthony 2013). Restricted feeding (RF) slows follicle growth and attenuates metabolic imbalances from overfeeding, resulting in reduced number of hierarchical follicles and improved egg production (Hocking et al. 1989, Yu et al. 1992b, Hocking & McCormack 1995, Diaz & Anthony 2013). Importantly, increased follicle sensitivity to endogenous gonadotropins is associated with increased recruitment of follicles into the ovarian hierarchy and lipotoxicity in BB hens (Yu et al. 1992c, Hocking & McCormack 1995, Chen et al. 2006, Diaz et al. 2011, Diaz & Anthony 2013, Walzem & Chen 2014).

Previous work from our lab has shown that the abundance of the steroidogenic transcripts Cyp11a1 (cytochrome P450 family 11 subfamily A member 1), Cyp19a1 (cytochrome P450 family 19 subfamily A member 1), Hsd3b1 (hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 1), and Star (steroidogenic acute regulatory protein) are increased in small follicles 1 mm in diameter compared to 0.5 mm follicles (Diaz et al. 2011) as well as in ovarian cortexes from BB hens given an ad libitum diet compared to those fed restricted diets (Diaz & Anthony 2013). Increased expression of steroidogenic proteins is associated with advanced development of cortical and prehierarchical follicles in full-feeding (FF) hens (Diaz & Anthony 2013).

The purpose of this study was to further explore transcriptional differences between ovarian cortexes of prepubertal BB hens consuming FF or RF diets. Using microarrays, the transcriptomes of 16-week FF and RF hens were probed for differentially expressed genes (DEGs) from which gene ontology (GO) enrichment analysis identified overrepresented GO terms and KEGG pathways. Genes of interest were selected for follow-up quantitative PCR (qPCR) analysis and validation which revealed several genes and pathways differentially regulated between FF and RF prepubertal BB hens, most notably those involved in steroid biosynthesis, extracellular matrix maintenance and remodeling, cell adhesion, and neuroactive signaling pathways including an increase in the vasoactive intestinal peptide (VIP) and its receptor VIPR2. Since VIP is known to regulate steroidogenesis in granulosa cells from larger follicles (Johnson & Tilly 1988, Johnson et al. 1994, Kim & Johnson 2016), we further assessed the effect of VIP on the expression of steroidogenic transcripts in small cortical follicles of prepubertal hens.

Materials and methods

Animals

Day-old Cobb 500 chicks were purchased from Longenecker's Hatchery (Elizabethtown, PA, USA) for these experiments. For the microarray and qPCR experiments, 20 chicks were raised to 10 weeks of age and 18 were raised to 16 weeks of age in accordance with the Cobb-Vantress breeder management guide (https://www.cobb-vantress.com/). From hatching until 2 weeks of age, chicks were given full access to feed, after which each age group was randomly divided in half. One treatment group continued a FF diet while the second group was placed on RF according to the breeder's guidelines. The RF group was closely monitored to assure recommended growth rate until ovary collection at 10 or 16 weeks. Feed was purchased from Wenger Feeds (Rheems, PA, USA), and the same starter, grower, and finisher rations were fed to both treatment groups. All BBs remained on 8 h of daylight until the end of the experiment. Hens were weighed and then euthanized by cervical dislocation. Ovaries were extracted, weighed, and processed as described below. Cortical follicles used for the VIP experiments were collected from ovarian cortexes of mature (30–55 weeks) BB hens raised according to growers' guidelines. All procedures on animals described herein were reviewed and approved by the Pennsylvania State University Institutional Animal Care and Use Committee and were performed in accordance with The Guide for the Care and Use of Agricultural Animals in Research and Teaching (Federation of Animal Science Societies 2010).

RNA isolation

Small sections (<1 cm3) of cortex from each ovary were placed in RNAlater (Thermo Fisher Scientific). Total RNA was isolated using the RNAeasy mini kit (Qiagen) according to the manufacturer's instructions and quantified using a NanoDrop 2000 spectrophotometer (Thermo Fisher Scientific). For Affymetrix array hybridization, RNA was extracted from the 16-week-old ovarian cortex samples and delivered to the Genomics Core Facility at the Huck Institutes of the Life Sciences at the Pennsylvania State University for subsequent processing. The sample quality was evaluated on an Agilent Bioanalyzer 2100 (Agilent Technologies) and only samples with an RNA integrity number (RIN) above 9 were selected from which three samples in each group were chosen randomly for microarray analysis.

RNA processing and chip hybridization were conducted using a 3' IVT Express Kit (Thermo Fisher Scientific) following the manufacturer's recommendations. For qPCR validation, independent samples from both 10- and 16-week-old ovarian cortex were analyzed. RNA quality and quantity were assessed on the Experion Automated Electrophoresis System using the Experion RNA StdSens analysis kit (Bio-Rad). The Experion features an RNA quality indicator (RQI) to assess RNA integrity which ranges between 1 (completely degraded) and 10 (intact RNA). An RQI greater than 7 was considered acceptable with all samples ranging between 8.5 and 9.7. Cortex samples from four randomly selected FF and RF hens at both 10 and 16 weeks were analyzed for validation.

Microarray

Six Affymetrix GeneChip Chicken Genome Arrays were purchased from Affymetrix. Sequence information is publicly available from GenBank®, UniGene (Build 18; 15 May 2004) and Ensembl (GRCg6a released April 2018). RNA from ovarian cortical tissue from three FF and RF 16-week-old hens were hybridized using a 3' IVT Express Kit (Thermo Fisher). Arrays were scanned with an Affymetrix GeneChip Scanner 3000 7G, and expression intensities were normalized using the Robust Multiarray Average method commonly used with Affymetrix chips (Irizarry et al. 2003). Unannotated probes were removed, and overrepresented gene ontologies and pathways were identified using the DAVID (Database for Annotation, Visualization, and Integrated Discovery) v6.8 platform (Huang et al. 2009a, b). Processed microarray results are available online on the NCBI GEO database accession number GSE184105.

qPCR

For each sample, 1 µg of total RNA was reverse transcribed using the QuantiTect RT kit (Invitrogen) according to manufacturer's instructions, diluted 1:5 with nuclease-free water, and stored at −20°C. Primers (Table 1) were designed with Primer3 (version 0.4.0 University of Tartu, Tartu, Estonia). Amplification reactions were prepared in duplicate, in 10 µL volumes containing 10 ng cDNA, 200 nM of each primer, and 5 µL 2X PerfeCTa SYBR Green FastMix Low Rox (Quanta Biosciences, Inc., Gaithersburg, MD, USA), then run on a 7500 Fast Real-Time PCR System (Applied Biosystems) using default fast conditions: initial hold at 95°C for 20 s, followed by 40 cycles each at 95°C for 3 s and 60°C for 30 s. CT values were calculated using the 7500 software (v.2.0.4) and expression was quantified by the ΔΔCt method (Livak & Schmittgen 2001) (18) with Rpl19 (ribosomal protein L19) mRNA as the normalizer gene (Johnson & Lee 2016). All amplification products were sequenced for gene verification.

Table 1

List of gene transcripts and their respective qPCR primers.

Gene Forward primer Reverse primer
Anxa2 AGCAAGCTCAGTCTGGAAGG CTTTGGTCTTGATGGCTGCT
Cath3 GCTGTGGACTCCTACAACCAA CCATGATGGTGAAGTTGAGGT
Ccdc80 GGCCAACCTCCTGGACTATT CTTGTTGCCATCTTGCAGAA
Cd36 GGCCATCTTTGGAGGAGTTC AACAGAGCTTCCTGGCACAA
Cdh13 TTACTCTGTCCTTTCTGCTGTCC CAGGTTCAGAATTGGCTGGT
Chrm5 CCTGTGGCTAGCACTGGATT TCATGATGCCAGCTCTTTTG
Cldn18 CGGCCATATTTCACCATTCT CGGATGCACTTCATAGCAAA
Col1a2 TGCTCAGCTTTGTGGATACG GTGGCCCTTTGTCTCCTCTA
Col3a1 TTCATTCTTGCCGTGTTTCA ATTTGGCATGGCTCTGGTT
Col4a2 CGCGTGTTTCTGTTTGTCAG CCTCCACTGCAGTCTCTTCC
Col6a1 GCTGCACGACTCCTTCTTG TGTCCAGCACAAAGAACAGG
Cyp11a1 CAAGACATGGCGTGACCA TGAAGAGGATGCCCGTGT
Cyp19a1 CACATGGGAGATTTCTCTGGA ACGTGAAATACGCTGGAGGA
Dhcr24 CTCCATCCTCTTCGACGTGT ATCTCCTGCCACCTTCCTC
Dlx5 AGCCCCTACCACCAGTACG ATAAATAGTCCGCGGTTTGC
Drd4 GCTCAAGACCACCACCAACT CAGTGCTGAGGGACCACAC
Fhl2 AGGGAGGACAGCCCCTACT GAAGCAGGTTTCATGCCAGT
Fn1 GGGGAACACGTTGGTCTGTA GCGCTCATAAGTCTCCCCTA
Gabbr2 TGGTGGTGTATGTGCAACTG GGCACTGTCCGGAAGAAATA
Gabra3 TGGCATCTCTCTCTCTTGCTG AGGATGCGTGTGAAAATGGT
Gabra5 CTGGAATGGACAATGGAACA TCCTCTTTTCCTGGTGCTGT
Gal7 GGATCCTTTACCTGCTGCTG TTCGACAGATCCCTGGAAAG
Grid1 GGTGGCAGAAATTCATCGTC TGGCAAAGACTCTGCTGATG
Hmgcr TGGAACTATGAGTGCCCAAA CCGAGTTGCCTTAGGTTCTG
Hsd17b1 GAGAAGACCACGGTGCTGAT GGCCAGGTCACGCATAGT
Hsd3b2 CAGCTGCTCTGGGAAGTCA GGGTCACCCCTGCAGTTT
Lama2 AAGTTTGCCGTTCCTCCTG GCATTGGTTGTGATGAGAGC
Lect2 CAGCGGGAATCCTTTCAATA TGATCCATCAGTGCAGATGAC
Mgll AAAGCGGAGTCCTCAAAACA CCATGAGCGATAAACACGAG
Mmp10/Mmp3 GGCTCCAGAAACTGCAAATG TCAGCCATGTGGTTGAGATT
Mmp9 GACCACATGGACCTCACGTA GTGAAGGTGAGGGGAGTGAC
Myh11 CTCCAAAGTGGAGGACATGG TGGGTTTATCACAACGCAGA
Negr1 ACTCCCAGAACAATGCAGGT AGATGGAGGGCTCTGGTTTC
Nell2 TGACCTTAAAACAAGCCCATTT TGCCTGTACGGTAATGCAAC
Postn TCCACGTTTTTCTTGTCTGCT TGGTTCCCATAACTTGCTGA
Pten CCTCAACCTTTGCCGGTAT TGTCTGAATTTTCATCCAGTCCT
Rbp4 CGTGTGAGCAGCTTCAAAGT AGTGAACTGGGCAACCACAT
Rpl19 CCCAACGAGACCAACGAG CCAAGGTGTTCTTCCTGCAT
Satb2 CGTGGGAGGTTTGATGATTC ACCAGCTGGCTAAAGAGCAC
Star CCAGCGTCAAAGAGGTGAA GAGCACCGAACACTCACAAA
Stard4 GCTACCAGGCTGCAGAACA TCCACTGAATTCTTCTGATGGTT
Supt3h GGATGGGCAAATCAACAAGT CAGCTGAGTGTGGACGATGT
Tead1 GTGTGGGAGGAGGAAAATCA TGGCAAGAACCTGAATGTGA
Vcan CATCATATGGATGTGCTCTACGTT TATGGTGGGTGTGGTTGAAA
Vip CGACTGGGAAACAGACTGC TCAATAATTCTGGACAGATCGAAA
Vipr1 CCTGGCAGAGATCACTGAGG AAGTACTTTGGGCATGGCTTC
Vipr2 AGGAAGCAAAGTGCATGGAA TTGGACAAGGGACAGTGACA

Cortical follicle isolation and culture

Follicles approximately 0.4 mm in diameter were excised from ovarian cortexes by carefully teasing them away from the surrounding connective tissue with fine, sterile forceps and hypodermic needles in DMEM ((HyClone, Thermo Scientific) containing 2.5% fetal bovine serum, 100 IU/mL penicillin, 100 µg/mL streptomycin, and 0.1 mM non-essential amino acids). Five follicles were used for each of four replicates which were allocated to the following treatments: Fresh (at collection without incubation or treatment), media only (control), and either 1 µM Vasoactive Intestinal Octacosapeptide (Phoenix Pharmaceuticals, Inc. Burlingame, CA, USA) or 10 ng/mL rhFSH (National Hormone and Pituitary Program, Torrance, CA, USA). The dose of VIP and follicle-stimulating hormone (FSH) was previously shown to induce a robust increase in steroidogenesis in granulosa cells from prehierarchical follicles (Johnson et al. 1994, Johnson & Lee 2016, Kim & Johnson 2016). The bioactivity of the FSH preparation was confirmed by the induction of STAR mRNA in granulosa cells from 6 to 9 mm follicles (data not shown). Follicles were punctured with a 30G hypodermic needle to remove oocyte contents, thus allowing better perfusion of the follicle with treatment media. For each replicate, 200 µL of media-containing follicles was transferred to a free-standing 2 mL microcentrifuge tube and allowed to equilibrate at 40°C with 5% CO2 for 30 min and then incubated in a gently shaking 40°C water bath overnight (17 h). Transcript abundance for Star, Cyp11a1, Vipr1 (VIP receptor 1), and Vipr2 in VIP-treated samples, or Star and Fshr in FSH-treated samples, was measured via qPCR as detailed above.

Statistical analysis

Real-time qPCR ΔΔCt values were analyzed by two-way ANOVA with hen age and feeding level as the two factors and an interaction term. A multiple test correction was performed using the Benjamini-Hochberg (BH) procedure with a false discovery rate of 0.05 (Benjamini & Hochberg 1995). Transcript abundances for VIP- and FSH-treated follicles were assessed by one-way ANOVA with Tukey's HSD. All analyses were performed in R and a significance threshold of α = 0.05 was used for all statistical tests.

Results

Gene functional annotation

Of more than 38,000 microarray probes, 18,745 remained after removing unannotated probes representing 11,561 unique genes. From this subset, 386 DEGs having a greater than two-fold difference were identified in total with 151 having greater abundance in FF hens and 235 in RF hens. The two DEG lists were uploaded to the DAVID Functional Annotation Tool to annotate related GO terms by cellular components, molecular functions, and biological processes. The GO analyses provided an overall assessment on the differences in cellular and molecular regulation in the ovaries of FF and RF hens. Results from KEGG analysis grouped the DEGs into pathways (Fig. 1). Enriched KEGG pathways determined by DAVID's Fisher Exact Statistics with BH correction include the neuroactive ligand–receptor interaction, cell adhesion molecules, steroid hormone biosynthesis, focal adhesion, extracellular matrix–receptor interaction, androgen and estrogen metabolism, and MAPK signaling pathways.

Figure 1

Figure 1

Heatmap of the significant GO terms (y-axis) and some of the top genes from the microarray (x-axis). Boxes indicate if the gene belongs to the GO term and if it is increased (red) or decreased (blue) compared to RF hens.

Citation: Reproduction and Fertility 3, 2; 10.1530/RAF-21-0098

  • Download Figure

Selection of DEGs for qPCR validation

To increase confidence in our microarray results and focus on our original hypotheses, genes representative of our functional annotation results were selected for qPCR validation on an independent group of cortical ovary samples (n = 4 each of 10- and 16-week-old FF and RF hens). Ultimately, 46 genes were selected for qPCR validation, from which 27 had similar statistical results between the microarray and qPCR results. The remaining genes were not statistically significant in either the qPCR or microarray while no genes had a disagreement between the two methods.

qPCR results from 10- and 16-week-old hens

Of the 46 genes selected for qPCR to compare between 10- and 16-week FF and RF hens, 33 had at least one mean ΔΔCt value that was significantly different from the other means as identified by two-way ANOVA with BH correction. Of these 33 genes, only Hsd17b1 (hydroxysteroid 17-beta dehydrogenase 1) had a statistically significant interaction term between the hen age and feed type. Further, 26 genes had statistically different expression based on feed type (RF vs FF) while 21 genes were found to have significantly different abundance based on BB age (10- vs 16 week old).

Neuropeptide signaling

Six of the ten genes analyzed by qPCR in the neuroactive ligand–receptor interaction group of genes had significantly different abundance by feed type, of which included Chrm5 (cholinergic receptor muscarinic 5), Drd4 (dopamine receptor D4), Gabra3 (gamma-aminobutyric acid type A receptor subunit alpha3), Gabra5, Nell2 (neural EGFL like 2), and Vipr2 (Fig. 2). Of these genes, Nell2 and Vipr2 were significantly reduced while Chrm5, Drd4, Gabra3, and Gabra5 were significantly more abundant in RF hens compared to FF hens. Three genes in this pathway, Grid1 (glutamate ionotropic receptor delta type subunit 1), Vip, and Vipr2, had their relative expression reduced from 10- to 16-weeks of age. Gabbr2 (gamma-aminobutyric acid type B receptor subunit 2) and Vipr1 did not have any statistically significant differences between the groups studied.

Figure 2

Figure 2

Stripchart of the nine genes belonging to the Neuroactive group. Each point represents a replicate from qPCR analysis while horizontal lines indicate means and vertical lines s.d. FF hens are represented in green and RF hens in blue with the darker shades indicating 16-week-old hens. For the calculation of ddCt values, RPL19 was used as the normalizer gene and the average dCt value from the 10-week RF hens was used as the reference group. Asterisks (*) indicate statistically significant differences by age and crosses (+) indicate statistically significant differences by feed (*, + P < 0.037, **,++ P < 0.01, ***,+++ P < 0.001, ****,++++ P < 0.0001).

Citation: Reproduction and Fertility 3, 2; 10.1530/RAF-21-0098

  • Download Figure

Cholesterol metabolism

The transcript expression of the two cholesterol transporter genes analyzed by qPCR, Star and Stard4, were both significantly less abundant from 10- to 16 weeks of age, and expression of both transcripts was reduced in RF hens (Fig. 3). Dhcr24 (24-dehydrocholesterol reductase) but not Hmgcr (3-hydroxy-3-methylglutaryl-CoA reductase), both of which are involved in cholesterol biosynthesis, also had significantly reduced abundance in RF hens. Conversely, Hmgcr but not Dhcr24 had elevated abundance in 16-week-old hens compared to BBs at 10 weeks of age. Four genes important for steroidogenesis, Cyp11a1, Cyp19a1, Hsd17b1, and Hsd3b2, similarly had significantly reduced abundance in RF hens, and in particular Hsd17b1 and Hsd3b2 saw a sharp increase in abundance from 10- to 16 weeks of age in FF hens that was absent in RF hens. Hsd17b1 had a statistically significant interaction term with increased abundance in 16-week FF hens compared to all other groups.

Figure 3

Figure 3

Stripchart of the eight genes belonging to the steroidogenic group. Each point represents a replicate from qPCR analysis while horizontal lines indicate means and vertical lines s.d. FF hens are represented in green and RF hens in blue with the darker shades indicating 16-week-old hens. For the calculation of ddCt values, RPL19 was used as the normalizer gene and the average dCt value from the 10-week RF hens was used as the reference group. Asterisks (*) indicate statistically significant differences by age, crosses (+) indicate statistically significant differences by feed, and ampersands (&) indicate a significant interaction term (*,+,& P < 0.037, **,++ P < 0.01, ***,+++ P < 0.001, ****,++++ P< 0.0001).

Citation: Reproduction and Fertility 3, 2; 10.1530/RAF-21-0098

  • Download Figure

Extracellular matrix

Of the two matrix metallopeptidases (MMPs) assessed by qPCR, both of which are zinc-binding proteases involved in ECM degradation, expression of Mmp10 but not Mmp9 was significantly less abundant in RF hens (Fig. 4). Similarly, the expression of collagen, type VI, alpha 1 (Col6a1) but not the other three collagen transcripts (collagen, type I, alpha 2 (Col1a2), collagen, type3, alpha1 (Col3a1), and collagen, type IV, alpha 2 (Col4a2)) were significantly less abundant in 10- and 16-week RF hens without an age effect. Expression ofAnxa2 (annexin A2),Fhl2 (four and a half LIM domains 2), Lama2 (laminin subunit alpha 2), and Vcan (versican)were less abundant in 16-week-old hens though significantly more abundant in FF hens while Fn1 (fibronectin 1) was more abundant in FF hens with no differences by age.

Figure 4

Figure 4

Stripchart of the ten genes belonging to the extracellular matrix group. Each point represents a replicate from qPCR analysis while horizontal lines indicate means and vertical lines s.d. FF hens are represented in green and RF hens in blue with the darker shades indicating 16-week-old hens. For the calculation of ddCt values, RPL19 was used as the normalizer gene and the average dCt value from the 10-week RF hens were used as the reference group. Asterisks (*) indicate statistically significant differences by age and crosses (+) indicate statistically significant differences by feed (*,+ P < 0.037, **,++ P < 0.01, ***,+++ P < 0.001, ****, ++++ P < 0.0001).

Citation: Reproduction and Fertility 3, 2; 10.1530/RAF-21-0098

  • Download Figure

Cell adhesion

Ccdc80 (coiled-coil domain containing 80), Cdh13 (cadherin 13), Mgll (monoglyceride lipase), Myh11 (myosin heavy chain 11), and Pten (phosphatase and tensin homolog) all had significantly lower abundance in 16-week-old hens compared to their 10-week old counterparts with significantly higher abundance in FF hens (Fig. 5). Negr1 (neuronal growth regulator 1) also was less abundant in the older hens but its expression was unaffected by feed type. Conversely, Postn (periostin) expression was slightly more abundant in FF hens but was not different by hen age. Although Cldn18 (claudin 18) had statistically reduced abundance in 16-week-old hens, there was a great degree of variability in 10-week old hens. Cd36 (cluster of differentiation 36) was the only gene in this group to not have statistical significance.

Figure 5

Figure 5

Stripchart of the eight genes belonging to the cellular adhesion group. Each point represents a replicate from qPCR analysis while horizontal lines indicate means and vertical lines s.d.. FF hens are represented in green and RF hens in blue with the darker shades indicating 16-week-old hens. For the calculation of ddCt values, RPL19 was used as the normalizer gene and the average dCt value from the 10-week RF hens was used as the reference group. Asterisks (*) indicate statistically significant differences byage and crosses (+) indicate statistically significant differences by feed (*,+ P < 0.037, **,++ P < 0.01, ***,+++ P < 0.001, ****,++++ P < 0.0001).

Citation: Reproduction and Fertility 3, 2; 10.1530/RAF-21-0098

  • Download Figure

Transcription and defense

In the transcription and defense set of genes, only three of the eight quantified by qPCR were differentially expressed with Dlx5 (distal-less homeobox 5) having reduced abundance while Satb2 (SATB homeobox 2) and Supth3 (SPT3 homolog, SAGA and STAGA complex component) had increased abundance at 16-week compared to the 10-week-old hens (Fig. 6). No genes in this group had statistical significance between the RF and FF feed types. A high degree of variance was observed for Cath3 (cathelicidin-3),Gal7 (Lgasl7), andleukocyte cell-derived chemotaxin 2Lect2 (leukocyte cell derived chemotaxin 2) in the 16-week-old FF hens.

Figure 6

Figure 6

Stripchart of the eight genes belonging to the transcription and defense group. Each point represents a replicate from qPCR analysis while horizontal lines indicate means and vertical lines s.d.. FF hens are represented in green and RF hens in blue with the darker shades indicating 16-week-old hens. For the calculation of ddCt values, RPL19 was used as the normalizer gene and the average dCt value from the 10-week RF hens was used as the reference group. Asterisks (*) indicate statistically significant differences by age and crosses (+) indicate statistically significant differences by feed (*,+ P < 0.037, **,++ P < 0.01, ***,+++ P < 0.001, ****,++++ P < 0.0001).

Citation: Reproduction and Fertility 3, 2; 10.1530/RAF-21-0098

  • Download Figure

VIP- and FSH-induced expression of steroidogenic transcripts

Follicles with a diameter of 0.4 mm were selected as they fall within the cut-off for large cortical follicles in BBs and contain both a theca and granulosa layer, thus would be responsive to steroidogenic activators and able to synthesize the cholesterol transporter STAR. After 17 h, VIP-treated follicles maintained Star abundance equal to that of fresh samples while follicles cultured without VIP did not maintain Star expression (Fig. 7A). The VIP-treated follicles had a lower abundance of Cyp11a1 or Vipr2 expression compared to fresh follicles (Fig. 7B, C, and D). However, VIP treatment increased the abundance of Vipr1 by five-fold (Fig. 7B, C, and D). Conversely, follicles cultured for 17 h with FSH were unable to maintain Star abundance even though the follicles do express the FSH receptor (Fig. 8).

Figure 7

Figure 7

Relative expression of (A) Star, (B) Cyp11a1, (C) Vipr1, and (D) Vipr2 in fresh and 17-h culture with control- or 1 µM VIP-treated 0.4 mm follicles from BB ovarian cortexes (n = 4). Treatments that share letters are not significantly different from one another (P > 0.05).

Citation: Reproduction and Fertility 3, 2; 10.1530/RAF-21-0098

  • Download Figure

Figure 8

Figure 8

Relative expression of (A) Star and (B) Fshr in fresh and 17-h culture with control- or 10 ng/mL FSH-treated 0.4 mm follicles (n = 4). Treatments that share letters are not significantly different from one another (P > 0.05).

Citation: Reproduction and Fertility 3, 2; 10.1530/RAF-21-0098

  • Download Figure

Discussion

The intraovarian defects that cause excessive follicular development in BB hens and how feed level modulates ovarian activity remains to be fully defined. Previously, our lab has shown that ad libitum feeding causes not only increased selection of hierarchical follicles but also increased development of prehierarchical follicles from 9 mm to small (~1 mm) cortical follicles to suggest that unrestricted feeding results in increased follicle activation and/or early growth (Diaz & Anthony 2013). In the present study, the transcriptome of ovarian cortical tissue in 16-week-old FF and RF BB hens was analyzed to identify genetic pathways modulated by the plane of nutrition during early follicular development.

From the >38,000 probes that comprised the Affymetrix microarray chip, 386 DEGs (~3.3% of all annotated, unique probes) were identified based on a >two-fold difference in expression between 16-week-old FF and RF hens. Using functional annotation analysis through DAVID (Huang et al. 2009a, b), DEGs were classified into the neuroactive ligand–receptor interaction, cell adhesion molecules, steroid hormone biosynthesis, focal adhesion, and the transcription and defense categories. Representative transcripts from these groups and specific transcripts previously shown to be differentially expressed in FF and RF hen ovaries were selected for follow-up with qPCR validation and analysis.

The ovary is a well-known source of steroid hormones. In the hen, large prehierarchical and hierarchical follicles are major sites of synthesis for both estrogen and progesterone (Bahr & Johnson 1984, Onagbesan et al. 2009, Johnson 2015). Although not a major source of systemic steroids, the small cortical follicles and ovarian stroma produce steroids locally (Nitta et al. 1991, Lee & Bahr 1994, Lee et al. 1998). Similar to our previous RF study with 17-week-old BB hens (Diaz & Anthony 2013), the steroidogenic transcripts Cyp11a1, Cyp19a1, Hsd3b, and Star were elevated in 10- and 16-week old FF hens. This finding is in agreement with other studies that found the abundance of Cyp11a1 and Cyp19a1 mRNA, in addition to Cyp17a1 (Cytochrome P450 Family 17 Subfamily A Member 1), to increase from 0.4 to 1.6 mm follicles (Zhou et al. 2020). Further, we observed in this study that three other steroidogenic transcripts, Stard4, Dhcr24, and Hsd17b1, were elevated in FF hens at 16 weeks of age. These data indicate that pathways involved in steroid production are upregulated prematurely in BB hens fed ad libitum, which corresponds with increased follicular development (Diaz & Anthony 2013), at least 1–2 weeks before sexual maturity and could be a driver of the earlier propensity of FF hens to reach sexual maturity compared to RF hens (Yu et al. 1992b).

Follicular development is associated with dynamic remodeling of the ovarian stroma as follicles continually grow, regress, and ovulate. Consistent with increased follicular development in FF hens, we found that transcripts involved in extracellular maintenance and remodeling were elevated in FF hens compared to their RF counterparts. This finding is sensible as FF hens have an increased number and size of cortical follicles which would require upregulation of genes involved in supporting their expanding extracellular matrix (Diaz & Anthony 2013). Many MMP transcripts are known to be modified following treatment with equine chorionic gonadotropin (eCG), which has FSH-like properties, in chicken ovaries, including the two MMPs studied in our qPCR analysis, MMP9 and MMP10 (Wolak et al. 2021). Importantly, MMP9 is suppressed while MMP10 is elevated in yellow follicles following eCG treatment (Wolak et al. 2021). In our qPCR analysis, MMP10 but not MMP9 was found to be statistically elevated in FF hens and appears to follow a similar trend with the findings from Wolak et al. (2021).

Fhl2, an assembler of extracellular membranes, is expressed in rat GCs where it acts as a transcriptional coactivator that augments inhibin transcriptional expression (Matulis & Mayo 2012). The hyaluron-binding proteoglycan versican (Vcna) has been relatively unstudied in avian species, although in rodents the protein is expressed along the matrix of the granulosa layer throughout folliculogenesis, particularly during ovulation (Russell et al. 2003). Fibronectin is a component of the ovarian follicle basal lamina which is upregulated during vitellogenesis in salmon follicles (Guzmán et al. 2014). Fibronectin protein abundance also increases in granulosa cells of mature hen follicles (Asem et al. 1992). Our qPCR results follow similarly as Fhl2, Vcna and Fn1 increase in FF hens at the ages studied, indicative of advanced follicle growth and maturity.

Col6a1, but not three other collagen transcripts, Col1a2, Col3a1, and Col4a2, was significantly upregulated in FF hens. Little is known about the Col6a1 collagen transcript in hen ovaries. In separate transcriptomic assessments, Col6a1 abundance and collagen thickness were found to increase from 0.4 to 1.6 mm follicles (Zhou et al. 2020), while conversely Col6a1 is downregulated in granulosa cells from F5 follicles compared to 6 mm prehierarchical follicles (Zhu et al. 2019). Our data appear to be in agreement with Zhou et al. (2020) as prepubescent FF BBs display increased numbers of 0.1–0.5 mm follicles compared to RF hens (Diaz & Anthony 2013), and therefore increased abundance of some collagen transcripts could be expected from cortex samples.

Pten serves to inhibit primordial follicle activation through the inactivation of the PI3K-Akt-Foxo3 pathway (John et al. 2008). qPCR analysis showed a statistically significant increase in Pten abundance in FF hens. This was surprising as one might expect Pten to be suppressed since FF hens have more growing follicles than RF hens at 16 weeks of age (Diaz & Anthony 2013). It may be that other pathways that induce the activation of primordial follicles are overriding the inhibitory actions of Pten and/or that the increase in Pten expression in FF hens is not enough to fully suppress the numbers of growing follicles.

In the neuroactive ligand–receptor interaction group, several interesting changes were noted. First, Grid1 abundance was significantly suppressed in 16-week-old hens. In sheep, GRID1 has been identified as a major candidate gene for affecting reproductive prolificacy (Nosrati et al. 2019), although a specific role for Grid1 in reproductive processes in the ovary is unknown. In two RNA-seq studies, using whole-ovary tissue of low- and high-egg producing Jinghai Yellow Chickens (Zhang et al. 2019) and Jinding Ducks (Tao et al. 2017), KEGG analysis similarly identified the neuroactive ligand–receptor interaction pathway to be highly enriched independent of body weight. In Jinghai Yellow Chickens of similar weight but grouped as either having high or low egg production, expression of Chrm5 was reduced in low egg-producing hens compared to hens that produced a relatively high number of eggs (Zhang et al. 2019). Conversely, the same study identified Vipr2 to have a greater expression in the hens producing a relatively low number of eggs (Zhang et al. 2019). Our results also show that Chrm5 transcript abundance is lower and Vipr2 higher in FF hens which are known to have lower egg production compared to RF hens. Whether the altered abundance of these two genes is a cause or a result of ovarian dysfunction in FF hens remains to be determined.

VIP-positive nerve fibers are located in the theca layer of small cortical (<5 mm) and prehierarchical follicles (6–9 mm) (Johnson et al. 1994). Moreover, VIP added to granulosa cells in vitro from either preovulatory or prehierarchical follicles promotes the expression of steroidogenic enzymes and progesterone production (Johnson & Tilly 1988, Advis et al. 1989, Johnson et al. 1994). In rats, VIP has been reported to promote primordial follicle activation and early growth (Chen et al. 2013). Two VIP receptors, VIP receptor 1 (VIPR1, also known as VIP and pituitary adenylate cyclase-activating polypeptide (PACAP) receptor 1 (VPAC1)) and VIPR2 (also known as VPAC2), are Gas-protein coupled receptors that bind both VIP and PACAP to stimulate adenylate cyclase activity (Laburthe et al. 2002). Both VIP receptors are expressed in ovarian granulosa and theca tissue from early follicle growth up until ovulation (Kim & Johnson 2016). The steroidogenic effects of VIP and expression of VIP receptors in follicles still contained within the hen ovarian cortex, particularly those in prepubertal hens, has yet to be resolved. In our study, Vipr2 but not Vipr1 was more abundant in FF hens at both 10 and 16 weeks of age. Although little is known about these transcripts in the hen ovary, in mouse ovaries both VIPR1 and VIPR2 are present in granulosa cells and residual ovarian tissue where they prevent granulosa cell apoptosis upon stimulation by VIP (Barberi et al. 2007). Additionally, VIP is known to stimulate adenylyl cyclase-mediated steroidogenesis in the granulosa cells of hens (Johnson & Tilly 1988). Therefore, we sought to examine if VIP affected steroidogenesis in the immature BB ovary, and indeed VIP does maintain Star transcript abundance in cultured cortical follicles although it did not significantly affect Cyp11a1 expression. Interestingly, the expression of Vipr2 was reduced while Vipr1 increased in follicles following VIP treatment.

While differences were found in the expression of one of the receptors for VIP, the abundance of Vip was not different statistically among the four groups. The expression of Nell2, a peptide growth factor containing EGF-like repeats, was increased ~four-fold in FF hens at 10 and 16 weeks of age compared to their RF counterparts. While little is known about Nell2 in non-neural tissues, particularly in hen ovaries, there is some evidence to speculate that it may be involved in the release of VIP as Nell2 is expressed in glutamatergic neurons (Ha et al. 2008) and glutamate stimulates VIP release in the cat cerebral cortex (Wang et al. 1986). In the same study with cats, antagonists to the neurotransmitter gamma-aminobutyric acid (GABA) also stimulate VIP release (Wang et al. 1986), and findings in our qPCR results identify at least two GABA receptors (Gabra3 and Gabra5) to be suppressed in FF hens. Secondly, the expression of two adenylyl cyclase inhibitors, Chrm5 and Drd4, is reduced in FF hens. While much more experimentation must be done to confidently elucidate the role of VIP and VIP-regulatory genes in the ovarian disruption observed in FF hens, an interesting supposition that VIP may be involved not be transcriptional regulation of its own gene but of a multi-tiered regulatory scheme that involves upregulation of its release (Nell2) and of a receptor (Vipr2) alongside downregulation of VIP release inhibitors (Chrm5, Drd4, Gabra3, and Gabra5) in FF hens emerges.

In adult hen ovaries, gonadotropins stimulate Star expression and progesterone production only form prehierarchical follicles about ready to enter the hierarchy 6–8 mm in diameter (Johnson et al. 2002). Previous work demonstrated that VIP can also increase progesterone production and/or STAR expression in preovulatory granulosa cells (Johnson & Tilly 1988) and prehierarchical follicles 6–8 mm (Johnson et al. 1994). However, VIP-positive nerve tracts can be found even in small 0.5 mm follicles (Johnson et al. 1994). In the present study, we show that even these small cortical follicles are sensitive to VIP as indicated by increased Star transcript abundance. However, they may not be fully responsive since VIP did not increase the abundance of Cyp11a1.

In our study, VIP was unable to maintain Vipr2 expression while Vipr1 increased over five-fold after 17 h. This finding was surprising as it did not reflect our qPCR results where Vipr2 but not Vipr1 was upregulated in FF hens. It is possible that responsiveness to VIP through changes in expression of its receptors may be influenced by VIP treatment. Culture with VIP did however maintain Star expression in hen ovarian cortexes to a level nearly identical to fresh tissue indicating that, at least in the immature ovary, VIP can modulate gene expression likely through effects on cells other than the granulosa.

Conclusions

Overall, many of the DEGs that were identified are increased in FF vs RF hens, suggesting that these pathways are positively correlated with follicle activation and early growth. Pathways involved in steroidogenesis, cell adhesion, and remodeling of the ECM were particularly upregulated in FF hens, indicating a central role of these pathways in follicle activation and or early growth. Future work could exploit these changes to alter ovarian function in BB hens without the need for severe feed restriction. Finally, this study revealed a role for VIP in maintaining the capacity for steroid production in small cortical follicles and, interestingly, in the transcriptional regulation of its own receptor, Vipr2. How VIP signaling may mediate ovarian dysfunction in BB hens fed ad libitum and the possible interventions that may ameliorate these effects are the focus of future studies.

Declaration of interest

The authors declare that there is no conflict of interest that could be perceived as prejudicing the impartiality of the research reported.

Funding

The work was funded by internal funds from the Pennsylvania State University College of Agricultural Sciences and supported in part by National Research Initiative Competitive Grant no. 2007-35206-17905 from the USDA Cooperative State Research, Education, and Extension Service to R R.

Author contribution statement

K A collected and analyzed data and wrote the paper, T B G analyzed data and wrote the paper. F J D conceived of the study and wrote the paper. R R wrote the paper.

Acknowledgements

The authors thank Jill Hadley for technical support in the completion of these studies. The authors also thank the Penn State Genomics Core Facility (University Park, PA) for processing the RNA samples and performing the microarray hybridization and scanning.

References

  • Advis JP , Ahmed CE & Ojeda SR 1989 Direct hypothalamic control of vasoactive intestinal peptide (VIP) levels in the developing rat ovary . Brain Research Bulletin 22 605 – 610 . (https://doi.org/10.1016/0361-9230(8990077-4)

    • PubMed
      • Advis JP Ahmed CE Ojeda SR 1989 Direct hypothalamic control of vasoactive intestinal peptide (VIP) levels in the developing rat ovary. Brain Research Bulletin22 605–610. (https://doi.org/10.1016/0361-9230(8990077-4)2736390

      )| false

    • Search Google Scholar
    • Export Citation

  • Asem EK , Carnegie JA & Tsang BK 1992 Fibronectin production by chicken granulosa cells in vitro: effect of follicular development . Acta Endocrinologica 127 466 – 470 . (https://doi.org/10.1530/acta.0.1270466)

    • PubMed
      • Asem EK Carnegie JA Tsang BK 1992 Fibronectin production by chicken granulosa cells in vitro: effect of follicular development. Acta Endocrinologica127 466–470. (https://doi.org/10.1530/acta.0.1270466)1281952

      )| false

    • Search Google Scholar
    • Export Citation

  • Barberi M , Muciaccia B , Morelli MB , Stefanini M , Cecconi S & Canipari R 2007 Expression localisation and functional activity of pituitary adenylate cyclase-activating polypeptide, vasoactive intestinal polypeptide and their receptors in mouse ovary . Reproduction 134 281 – 292 . (https://doi.org/10.1530/REP-07-0051)

    • PubMed
      • Barberi M Muciaccia B Morelli MB Stefanini M Cecconi S Canipari R 2007 Expression localisation and functional activity of pituitary adenylate cyclase-activating polypeptide, vasoactive intestinal polypeptide and their receptors in mouse ovary. Reproduction134 281–292. (https://doi.org/10.1530/REP-07-0051)17660238

      )| false

    • Search Google Scholar
    • Export Citation

  • Benjamini Y & Hochberg Y 1995 Controlling the false discovery rate: a practical and powerful approach to multiple testing . Journal of the Royal Statistical Society: Series B 57 289 – 300 . (https://doi.org/10.1111/j.2517-6161.1995.tb02031.x)

      Benjamini Y Hochberg Y 1995 Controlling the false discovery rate: a practical and powerful approach to multiple testing. Journal of the Royal Statistical Society: Series B57 289–300. (https://doi.org/10.1111/j.2517-6161.1995.tb02031.x)

      )| false

    • Search Google Scholar
    • Export Citation

  • Chen SE , McMurtry JP & Walzem RL 2006 Overfeeding-induced ovarian dysfunction in broiler breeder hens is associated with lipotoxicity . Poultry Science 85 70 – 81 . (https://doi.org/10.1093/ps/85.1.70)

    • PubMed
      • Chen SE McMurtry JP Walzem RL 2006 Overfeeding-induced ovarian dysfunction in broiler breeder hens is associated with lipotoxicity. Poultry Science85 70–81. (https://doi.org/10.1093/ps/85.1.70)16493948

      )| false

    • Search Google Scholar
    • Export Citation

  • Chen N , Li Y , Wang W , Ma Y , Yang D & Zhang Q 2013 Vasoactive intestinal peptide can promote the development of neonatal rat primordial follicles during in vitro culture . Biology of Reproduction 88 12. (https://doi.org/10.1095/biolreprod.111.098335)

    • PubMed
      • Chen N Li Y Wang W Ma Y Yang D Zhang Q 2013 Vasoactive intestinal peptide can promote the development of neonatal rat primordial follicles during in vitro culture. Biology of Reproduction88 12. (https://doi.org/10.1095/biolreprod.111.098335)23175772

      )| false

    • Search Google Scholar
    • Export Citation

  • Diaz FJ , Anthony K & Halfhill AN 2011 Early avian follicular development is characterized by changes in transcripts involved in steroidogenesis, paracrine signaling and transcription . Molecular Reproduction and Development 78 212 – 223 . (https://doi.org/10.1002/mrd.21288)

    • PubMed
      • Diaz FJ Anthony K Halfhill AN 2011 Early avian follicular development is characterized by changes in transcripts involved in steroidogenesis, paracrine signaling and transcription. Molecular Reproduction and Development78 212–223. (https://doi.org/10.1002/mrd.21288)21308853

      )| false

    • Search Google Scholar
    • Export Citation

  • Diaz FJ & Anthony A 2013 Feed restriction inhibits early follicular development in broiler-breeder hens . Animal Reproduction 10 79 – 87 .

      Diaz FJ Anthony A 2013 Feed restriction inhibits early follicular development in broiler-breeder hens. Animal Reproduction10 79–87.

      )| false

    • Search Google Scholar
    • Export Citation

  • Guzmán JM , Luckenbach JA , Yamamoto Y & Swanson P 2014 Expression profiles of Fsh-regulated ovarian genes during oogenesis in coho salmon . PLoS ONE 9 e114176. (https://doi.org/10.1371/journal.pone.0114176)

    • PubMed
      • Guzmán JM Luckenbach JA Yamamoto Y Swanson P 2014 Expression profiles of Fsh-regulated ovarian genes during oogenesis in coho salmon. PLoS ONE9 e114176. (https://doi.org/10.1371/journal.pone.0114176)25485989

      )| false

    • Search Google Scholar
    • Export Citation

  • Ha CM , Choi J , Choi EJ , Costa ME , Lee BJ & Ojeda SR 2008 NELL2, a neuron-specific EGF-like protein, is selectively expressed in glutamatergic neurons and contributes to the glutamatergic control of GnRH neurons at puberty . Neuroendocrinology 88 199 – 211 . (https://doi.org/10.1159/000139579)

      Ha CM Choi J Choi EJ Costa ME Lee BJ Ojeda SR 2008 NELL2, a neuron-specific EGF-like protein, is selectively expressed in glutamatergic neurons and contributes to the glutamatergic control of GnRH neurons at puberty. Neuroendocrinology88 199–211. (https://doi.org/10.1159/000139579)

      )| false

    • Search Google Scholar
    • Export Citation

  • Hocking PM , Waddington D , Walker MA & Gilbert AB 1989 Control of the development of the ovarian follicular hierarchy in broiler breeder pullets by food restriction during rearing . British Poultry Science 30 161 – 173 . (https://doi.org/10.1080/00071668908417134)

    • PubMed
      • Hocking PM Waddington D Walker MA Gilbert AB 1989 Control of the development of the ovarian follicular hierarchy in broiler breeder pullets by food restriction during rearing. British Poultry Science30 161–173. (https://doi.org/10.1080/00071668908417134)2743171

      )| false

    • Search Google Scholar
    • Export Citation

  • Hocking PM & McCormack HA 1995 Differential sensitivity of ovarian follicles to gonadotrophin stimulation in broiler and layer lines of domestic fowl . Journal of Reproduction and Fertility 105 49 – 55 . (https://doi.org/10.1530/jrf.0.1050049)

    • PubMed
      • Hocking PM McCormack HA 1995 Differential sensitivity of ovarian follicles to gonadotrophin stimulation in broiler and layer lines of domestic fowl. Journal of Reproduction and Fertility105 49–55. (https://doi.org/10.1530/jrf.0.1050049)7490714

      )| false

    • Search Google Scholar
    • Export Citation

  • Huang da W , Sherman BT & Lempicki RA 2009a Bioinformatics enrichment tools: paths toward the comprehensive functional analysis of large gene lists . Nucleic Acids Research 37 1 – 13 . (https://doi.org/10.1093/nar/gkn923)

      Huang da W Sherman BT Lempicki RA 2009a Bioinformatics enrichment tools: paths toward the comprehensive functional analysis of large gene lists. Nucleic Acids Research37 1–13. (https://doi.org/10.1093/nar/gkn923)

      )| false

    • Search Google Scholar
    • Export Citation

  • Huang da W , Sherman BT & Lempicki RA 2009b Systematic and integrative analysis of large gene lists using DAVID bioinformatics resources . Nature Protocols 4 44 – 57 . (https://doi.org/10.1038/nprot.2008.211)

      Huang da W Sherman BT Lempicki RA 2009b Systematic and integrative analysis of large gene lists using DAVID bioinformatics resources. Nature Protocols4 44–57. (https://doi.org/10.1038/nprot.2008.211)

      )| false

    • Search Google Scholar
    • Export Citation

  • Irizarry RA , Hobbs B , Collin F , Beazer-Barclay YD , Antonellis KJ , Scherf U & Speed TP 2003 Exploration, normalization, and summaries of high density oligonucleotide array probe level data . Biostatistics 4 249 – 264 . (https://doi.org/10.1093/biostatistics/4.2.249)

    • PubMed
      • Irizarry RA Hobbs B Collin F Beazer-Barclay YD Antonellis KJ Scherf U Speed TP 2003 Exploration, normalization, and summaries of high density oligonucleotide array probe level data. Biostatistics4 249–264. (https://doi.org/10.1093/biostatistics/4.2.249)12925520

      )| false

    • Search Google Scholar
    • Export Citation

  • John GB , Gallardo TD , Shirley LJ & Castrillon DH 2008 Foxo3 is a PI3K-dependent molecular switch controlling the initiation of oocyte growth . Developmental Biology 321 197 – 204 . (https://doi.org/10.1016/j.ydbio.2008.06.017)

    • PubMed
      • John GB Gallardo TD Shirley LJ Castrillon DH 2008 Foxo3 is a PI3K-dependent molecular switch controlling the initiation of oocyte growth. Developmental Biology321 197–204. (https://doi.org/10.1016/j.ydbio.2008.06.017)18601916

      )| false

    • Search Google Scholar
    • Export Citation

  • Johnson AL & Tilly JL 1988 Effects of vasoactive intestinal peptide on steroid secretion and plasminogen activator activity in granulosa cells of the hen . Biology of Reproduction 38 296 – 303 . (https://doi.org/10.1095/biolreprod38.2.296)

    • PubMed
      • Johnson AL Tilly JL 1988 Effects of vasoactive intestinal peptide on steroid secretion and plasminogen activator activity in granulosa cells of the hen. Biology of Reproduction38 296–303. (https://doi.org/10.1095/biolreprod38.2.296)2451937

      )| false

    • Search Google Scholar
    • Export Citation

  • Johnson AL , Li Z , Gibney JA & Malamed S 1994 Vasoactive intestinal peptide-induced expression of cytochrome P450 cholesterol side-chain cleavage and 17 alpha-hydroxylase enzyme activity in hen granulosa cells . Biology of Reproduction 51 327 – 333 . (https://doi.org/10.1095/biolreprod51.2.327)

    • PubMed
      • Johnson AL Li Z Gibney JA Malamed S 1994 Vasoactive intestinal peptide-induced expression of cytochrome P450 cholesterol side-chain cleavage and 17 alpha-hydroxylase enzyme activity in hen granulosa cells. Biology of Reproduction51 327–333. (https://doi.org/10.1095/biolreprod51.2.327)7948488

      )| false

    • Search Google Scholar
    • Export Citation

  • Johnson AL , Solovieva EV & Bridgham JT 2002 Relationship between steroidogenic acute regulatory protein expression and progesterone production in hen granulosa cells during follicle development . Biology of Reproduction 67 1313 – 1320 . (https://doi.org/10.1095/biolreprod67.4.1313)

    • PubMed
      • Johnson AL Solovieva EV Bridgham JT 2002 Relationship between steroidogenic acute regulatory protein expression and progesterone production in hen granulosa cells during follicle development. Biology of Reproduction67 1313–1320. (https://doi.org/10.1095/biolreprod67.4.1313)12297550

      )| false

    • Search Google Scholar
    • Export Citation

  • Johnson AL & Lee J 2016 Granulosa cell responsiveness to follicle stimulating hormone during early growth of hen ovarian follicles . Poultry Science 95 108 – 114 . (https://doi.org/10.3382/ps/pev318)

    • PubMed
      • Johnson AL Lee J 2016 Granulosa cell responsiveness to follicle stimulating hormone during early growth of hen ovarian follicles. Poultry Science95 108–114. (https://doi.org/10.3382/ps/pev318)26574040

      )| false

    • Search Google Scholar
    • Export Citation

  • Kim D & Johnson AL 2016 Vasoactive intestinal peptide promotes differentiation and clock gene expression in granulosa cells from prehierarchal follicles . Molecular Reproduction and Development 83 455 – 463 . (https://doi.org/10.1002/mrd.22641)

    • PubMed
      • Kim D Johnson AL 2016 Vasoactive intestinal peptide promotes differentiation and clock gene expression in granulosa cells from prehierarchal follicles. Molecular Reproduction and Development83 455–463. (https://doi.org/10.1002/mrd.22641)27021352

      )| false

    • Search Google Scholar
    • Export Citation

  • Laburthe M , Couvineau A & Marie JC 2002 VPAC receptors for VIP and PACAP . Receptors and Channels 8 137 – 153 .

    • PubMed
      • Laburthe M Couvineau A Marie JC 2002 VPAC receptors for VIP and PACAP. Receptors and Channels8 137–153.12529932

      )| false

    • Search Google Scholar
    • Export Citation

  • Lee KA & Bahr JM 1994 Utilization of substrates for testosterone and estradiol-17β production by small follicles of the chicken ovary . Domestic Animal Endocrinology 11 307 – 314 . (https://doi.org/10.1016/0739-7240(9490022-1)

    • PubMed
      • Lee KA Bahr JM 1994 Utilization of substrates for testosterone and estradiol-17β production by small follicles of the chicken ovary. Domestic Animal Endocrinology11 307–314. (https://doi.org/10.1016/0739-7240(9490022-1)7956177

      )| false

    • Search Google Scholar
    • Export Citation

  • Lee KA , Volentine KK & Bahr JM 1998 Two steroidogenic pathways present in the chicken ovary: theca layer prefers delta 5 pathway and granulosa layer prefers delta 4 pathway . Domestic Animal Endocrinology 15 1 – 8 . (https://doi.org/10.1016/s0739-7240(9700057-x)

    • PubMed
      • Lee KA Volentine KK Bahr JM 1998 Two steroidogenic pathways present in the chicken ovary: theca layer prefers delta 5 pathway and granulosa layer prefers delta 4 pathway. Domestic Animal Endocrinology15 1–8. (https://doi.org/10.1016/s0739-7240(9700057-x)9437580

      )| false

    • Search Google Scholar
    • Export Citation

  • Livak KJ & Schmittgen TD 2001 Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method . Methods 25 402 – 408 . (https://doi.org/10.1006/meth.2001.1262)

    • PubMed
      • Livak KJ Schmittgen TD 2001 Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods25 402–408. (https://doi.org/10.1006/meth.2001.1262)11846609

      )| false

    • Search Google Scholar
    • Export Citation

  • Matulis CK & Mayo KE 2012 The LIM domain protein FHL2 interacts with the NR5A family of nuclear receptors and CREB to activate the inhibin-α subunit gene in ovarian granulosa cells . Molecular Endocrinology 26 1278 – 1290 . (https://doi.org/10.1210/me.2011-1347)

    • PubMed
      • Matulis CK Mayo KE 2012 The LIM domain protein FHL2 interacts with the NR5A family of nuclear receptors and CREB to activate the inhibin-α subunit gene in ovarian granulosa cells. Molecular Endocrinology26 1278–1290. (https://doi.org/10.1210/me.2011-1347)22734036

      )| false

    • Search Google Scholar
    • Export Citation

  • Nitta H , Osawa Y & Bahr JM 1991 Immunolocalization of steroidogenic cells in small follicles of the chicken ovary: anatomical arrangement and location of steroidogenic cells change during follicular development . Domestic Animal Endocrinology 8 587 – 594 . (https://doi.org/10.1016/0739-7240(9190028-i)

    • PubMed
      • Nitta H Osawa Y Bahr JM 1991 Immunolocalization of steroidogenic cells in small follicles of the chicken ovary: anatomical arrangement and location of steroidogenic cells change during follicular development. Domestic Animal Endocrinology8 587–594. (https://doi.org/10.1016/0739-7240(9190028-i)1786705

      )| false

    • Search Google Scholar
    • Export Citation

  • Nosrati M , Asadollahpour Nanaei H , Amiri Ghanatsaman Z & Esmailizadeh A 2019 Whole genome sequence analysis to detect signatures of positive selection for high fecundity in sheep . Reproduction in Domestic Animals 54 358 – 364 . (https://doi.org/10.1111/rda.13368)

    • PubMed
      • Nosrati M Asadollahpour Nanaei H Amiri Ghanatsaman Z Esmailizadeh A 2019 Whole genome sequence analysis to detect signatures of positive selection for high fecundity in sheep. Reproduction in Domestic Animals54 358–364. (https://doi.org/10.1111/rda.13368)30359467

      )| false

    • Search Google Scholar
    • Export Citation

  • Onagbesan O , Bruggeman V & Decuypere E 2009 Intra-ovarian growth factors regulating ovarian function in avian species: a review . Animal Reproduction Science 111 121 – 140 . (https://doi.org/10.1016/j.anireprosci.2008.09.017)

    • PubMed
      • Onagbesan O Bruggeman V Decuypere E 2009 Intra-ovarian growth factors regulating ovarian function in avian species: a review. Animal Reproduction Science111 121–140. (https://doi.org/10.1016/j.anireprosci.2008.09.017)19028031

      )| false

    • Search Google Scholar
    • Export Citation

  • Robinson FE , Wilson JL , Yu MW , Fasenko GM & Hardin RT 1993 The relationship between body weight and reproductive efficiency in meat-type chickens . Poultry Science 72 912 – 922 . (https://doi.org/10.3382/ps.0720912)

      Robinson FE Wilson JL Yu MW Fasenko GM Hardin RT 1993 The relationship between body weight and reproductive efficiency in meat-type chickens. Poultry Science72 912–922. (https://doi.org/10.3382/ps.0720912)

      )| false

    • Search Google Scholar
    • Export Citation

  • Russell DL , Ochsner SA , Hsieh M , Mulders S & Richards JS 2003 Hormone-regulated expression and localization of versican in the rodent ovary . Endocrinology 144 1020 – 1031 . (https://doi.org/10.1210/en.2002-220434)

    • PubMed
      • Russell DL Ochsner SA Hsieh M Mulders S Richards JS 2003 Hormone-regulated expression and localization of versican in the rodent ovary. Endocrinology144 1020–1031. (https://doi.org/10.1210/en.2002-220434)12586779

      )| false

    • Search Google Scholar
    • Export Citation

  • Tao Z , Song W , Zhu C , Xu W , Liu H , Zhang S & Huifang L 2017 Comparative transcriptomic analysis of high and low egg-producing duck ovaries . Poultry Science 96 4378 – 4388 . (https://doi.org/10.3382/ps/pex229)

    • PubMed
      • Tao Z Song W Zhu C Xu W Liu H Zhang S Huifang L 2017 Comparative transcriptomic analysis of high and low egg-producing duck ovaries. Poultry Science96 4378–4388. (https://doi.org/10.3382/ps/pex229)29053813

      )| false

    • Search Google Scholar
    • Export Citation

  • Walzem RL & Chen SE 2014 Obesity-induced dysfunctions in female reproduction: lessons from birds and mammals . Advances in Nutrition 5 199 – 206 . (https://doi.org/10.3945/an.113.004747)

    • PubMed
      • Walzem RL Chen SE 2014 Obesity-induced dysfunctions in female reproduction: lessons from birds and mammals. Advances in Nutrition5 199–206. (https://doi.org/10.3945/an.113.004747)24618762

      )| false

    • Search Google Scholar
    • Export Citation

  • Wang JY , Yaksh TL , Harty GJ & Go VL 1986 Neurotransmitter modulation of VIP release from cat cerebral cortex . American Journal of Physiology 250 R104 – R111 . (https://doi.org/10.1152/ajpregu.1986.250.1.R104)

    • PubMed
      • Wang JY Yaksh TL Harty GJ Go VL 1986 Neurotransmitter modulation of VIP release from cat cerebral cortex. American Journal of Physiology250 R104–R111. (https://doi.org/10.1152/ajpregu.1986.250.1.R104)2867688

      )| false

    • Search Google Scholar
    • Export Citation

  • Wolak D , Sechman A & Hrabia A 2021 Effect of eCG treatment on gene expression of selected matrix metalloproteinases (MMP-2, MMP-7, MMP-9, MMP-10, and MMP-13) and the tissue inhibitors of metalloproteinases (TIMP-2 and TIMP-3) in the chicken ovary . Animal Reproduction Science 224 106666. (https://doi.org/10.1016/j.anireprosci.2020.106666)

    • PubMed
      • Wolak D Sechman A Hrabia A 2021 Effect of eCG treatment on gene expression of selected matrix metalloproteinases (MMP-2, MMP-7, MMP-9, MMP-10, and MMP-13) and the tissue inhibitors of metalloproteinases (TIMP-2 and TIMP-3) in the chicken ovary. Animal Reproduction Science224 106666. (https://doi.org/10.1016/j.anireprosci.2020.106666)33260067

      )| false

    • Search Google Scholar
    • Export Citation

  • Yu MW , Robinson FE & Robblee AR 1992a Effect of feed allowance during rearing and breeding on female broiler breeders. 1. Growth and carcass characteristics . Poultry Science 71 1739 – 1749 . (https://doi.org/10.3382/ps.0711739)

      Yu MW Robinson FE Robblee AR 1992a Effect of feed allowance during rearing and breeding on female broiler breeders. 1. Growth and carcass characteristics. Poultry Science71 1739–1749. (https://doi.org/10.3382/ps.0711739)

      )| false

    • Search Google Scholar
    • Export Citation

  • Yu MW , Robinson FE , Charles RG & Weingardt R 1992b Effect of feed allowance during rearing and breeding on female broiler breeders. 2. Ovarian morphology and production . Poultry Science 71 1750 – 1761 . (https://doi.org/10.3382/ps.0711750)

      Yu MW Robinson FE Charles RG Weingardt R 1992b Effect of feed allowance during rearing and breeding on female broiler breeders. 2. Ovarian morphology and production. Poultry Science71 1750–1761. (https://doi.org/10.3382/ps.0711750)

      )| false

    • Search Google Scholar
    • Export Citation

  • Yu MW , Robinson FE & Etches RJ 1992c Effect of feed allowance during rearing and breeding on female broiler breeders. 3. Ovarian steroidogenesis . Poultry Science 71 1762 – 1767 . (https://doi.org/10.3382/ps.0711762)

      Yu MW Robinson FE Etches RJ 1992c Effect of feed allowance during rearing and breeding on female broiler breeders. 3. Ovarian steroidogenesis. Poultry Science71 1762–1767. (https://doi.org/10.3382/ps.0711762)

      )| false

    • Search Google Scholar
    • Export Citation

  • Zaguri S , Bartman J , Avital-Cohen N , Dishon L , Gumułka M , Chaiseha Y , Druyan S & Rozenboim I 2020 Targeted differential monochromatic lighting improves broiler breeder reproductive performance . Poultry Science 99 3697 – 3708 . (https://doi.org/10.1016/j.psj.2020.03.007)

    • PubMed
      • Zaguri S Bartman J Avital-Cohen N Dishon L Gumułka M Chaiseha Y Druyan S Rozenboim I 2020 Targeted differential monochromatic lighting improves broiler breeder reproductive performance. Poultry Science99 3697–3708. (https://doi.org/10.1016/j.psj.2020.03.007)32616266

      )| false

    • Search Google Scholar
    • Export Citation

  • Zhang T , Chen L , Han K , Zhang X , Zhang G , Dai G , Wang J & Xie K 2019 Transcriptome analysis of ovary in relatively greater and lesser egg producing Jinghai Yellow Chicken . Animal Reproduction Science 208 (106114). (https://doi.org/10.1016/j.anireprosci.2019.106114)

    • PubMed
      • Zhang T Chen L Han K Zhang X Zhang G Dai G Wang J Xie K 2019 Transcriptome analysis of ovary in relatively greater and lesser egg producing Jinghai Yellow Chicken. Animal Reproduction Science208 (106114). (https://doi.org/10.1016/j.anireprosci.2019.106114)31405454

      )| false

    • Search Google Scholar
    • Export Citation

  • Zhou S , Ma Y , Zhao D , Mi Y & Zhang C 2020 Transcriptome profiling analysis of underlying regulation of growing follicle development in the chicken . Poultry Science 99 2861 – 2872 . (https://doi.org/10.1016/j.psj.2019.12.067)

    • PubMed
      • Zhou S Ma Y Zhao D Mi Y Zhang C 2020 Transcriptome profiling analysis of underlying regulation of growing follicle development in the chicken. Poultry Science99 2861–2872. (https://doi.org/10.1016/j.psj.2019.12.067)32475419

      )| false

    • Search Google Scholar
    • Export Citation

  • Zhu G , Fang C , Li J , Mo C , Wang Y & Li J 2019 Transcriptomic diversification of granulosa cells during follicular development in chicken . Scientific Reports 9 5462. (https://doi.org/10.1038/s41598-019-41132-1)

    • PubMed
      • Zhu G Fang C Li J Mo C Wang Y Li J 2019 Transcriptomic diversification of granulosa cells during follicular development in chicken. Scientific Reports9 5462. (https://doi.org/10.1038/s41598-019-41132-1)30940861

      )| false

    • Search Google Scholar
    • Export Citation

  • Zuidhof MJ , Schneider BL , Carney VL , Korver DR & Robinson FE 2014 Growth, efficiency, and yield of commercial broilers from 1957, 1978, and 2005 . Poultry Science 93 2970 – 2982 . (https://doi.org/10.3382/ps.2014-04291)

    • PubMed
      • Zuidhof MJ Schneider BL Carney VL Korver DR Robinson FE 2014 Growth, efficiency, and yield of commercial broilers from 1957, 1978, and 2005. Poultry Science93 2970–2982. (https://doi.org/10.3382/ps.2014-04291)25260522

      )| false

    • Search Google Scholar
    • Export Citation

smithprefor.blogspot.com

Source: https://raf.bioscientifica.com/view/journals/raf/3/2/RAF-21-0098.xml

0 Response to "What Happens to the Ovary if the Broiler Breeder is Over Feed"

Post a Comment

Subscribe to: Post Comments (Atom)

Iklan Atas Artikel

Iklan Tengah Artikel 1

Iklan Tengah Artikel 2

Iklan Bawah Artikel